MUTATE A DNA SENTENCE!
|
It's time to try your hand at mutating a DNA sequence. Here's the sequence: GCATGCTGCGAAACTTTGGCTGA First, try separating the sequence into three-letter codons. You can do this three ways:
How can you tell which of the three codon "reading frames" is the correct one? All genes begin with the three-letter sequence "ATG," which encodes the amino acid methionine (Met). Therefore, the correct reading frame will contain the codon "ATG." Next, predict the amino acid sequence of the protein encoded by the DNA sentence. Review "What is the Universal Genetic Code?" on the right side of this page. Then use the Code, shown below, to determine the amino acid sequence. Challenge Yourself! Once you've translated the DNA sequence, go back and try to make each of the mutations discussed at right.
|
What is the Universal Genetic Code?The Universal Genetic Code is the instruction manual that the cell uses to read the DNA sequence of a gene and produce a corresponding protein. Proteins are made of amino acids that are strung together in a chain. Each three-letter DNA sequence, or codon, encodes a specific amino acid. In this activity, we use the Universal Genetic Code to predict the amino acid sequence encoded by a DNA sequence. The code has several key features:
While we can reliably predict amino acid sequences from DNA sequences, cells use a slightly more complex process to get from DNA to proteins. To find out more about this process, see Transcribe and Translate a Gene and What Makes a Firefly Glow?. What types of mutations can occur in DNA sentences?Point mutations are single nucleotide base changes in a gene's DNA sequence. This type of mutation can change the gene's protein product in the following ways:
Insertion mutations and deletion mutations add or remove one or more DNA bases. Insertion and deletion mutations cause frameshift mutations, which change the grouping of nucleotide bases into codons. This results in a shift of "reading frame" during protein translation.
|

